DATA FILE PRINT FORMAT

From HyPhy Wiki
Jump to: navigation, search

DATA_FILE_PRINT_FORMAT determines the format in which DataSetFilter objects will be written to files or exported to strings.

Contents

Possible values

Value Effect
0 MEGA sequential
1 MEGA interleaved
2 PHYLIP sequential
3 PHYLIP interleaved
4 NEXUS sequential with sequence labels in data matrix
5 NEXUS interleaved with sequence labels in data matrix
6 (default) NEXUS sequential without sequence labels in data matrix
7 NEXUS interleaved without sequence labels in data matrix
8 Comma separated characters
9 FASTA sequential
10 FASTA interleaved

Commands that are affected by this environment variable

Examples

MEGA sequential (0)

#a
ATGATTCAACCTCAGACCCTTTTAAATGTAGCAGATAACAGTGGAGCTCG
AAAATTGATGTGTATTCGAGTCATAGGAGCTAGTAATCAGCGATATGCTC
#b
ATGATTCAACCTCAGACCCATTTAAATGTAGCGGATAACAGCGGGGCTCG
AGAATTGATGTGTATTCGAATCATAGGAGCTAGCAATCGTCGATATGCTC
#og
ATGATTCAACCTCAAACTTATTTAAATGTTGCAGATAATAGTGGAGCTCG
AAAACTAATGTGCATTCGAGTTATAGGAACGAGTAATCGAAAATATGCAA


((a,b),og);
                                                                                                                                       

MEGA Interleaved (1)

#a
#b
#og
 ATGATTCAAC CTCAGACCCT TTTAAATGTA GCAGATAACA GTGGAGCTCG
 ATGATTCAAC CTCAGACCCA TTTAAATGTA GCGGATAACA GCGGGGCTCG
 ATGATTCAAC CTCAAACTTA TTTAAATGTT GCAGATAATA GTGGAGCTCG

 AAAATTGATG TGTATTCGAG TCATAGGAGC TAGTAATCAG CGATATGCTC
 AGAATTGATG TGTATTCGAA TCATAGGAGC TAGCAATCGT CGATATGCTC
 AAAACTAATG TGCATTCGAG TTATAGGAAC GAGTAATCGA AAATATGCAA

((a,b),og);

PHYLIP Sequential (2)

3	100
a          ATGATTCAAC CTCAGACCCT TTTAAATGTA GCAGATAACA GTGGAGCTCG 
           AAAATTGATG TGTATTCGAG TCATAGGAGC TAGTAATCAG CGATATGCTC 
b          ATGATTCAAC CTCAGACCCA TTTAAATGTA GCGGATAACA GCGGGGCTCG 
           AGAATTGATG TGTATTCGAA TCATAGGAGC TAGCAATCGT CGATATGCTC 
og         ATGATTCAAC CTCAAACTTA TTTAAATGTT GCAGATAATA GTGGAGCTCG 
           AAAACTAATG TGCATTCGAG TTATAGGAAC GAGTAATCGA AAATATGCAA 
1
((a,b),og);


PHYLIP Interleaved (3)

3	100
a           ATGATTCAAC CTCAGACCCT TTTAAATGTA GCAGATAACA GTGGAGCTCG
b           ATGATTCAAC CTCAGACCCA TTTAAATGTA GCGGATAACA GCGGGGCTCG
og          ATGATTCAAC CTCAAACTTA TTTAAATGTT GCAGATAATA GTGGAGCTCG

            AAAATTGATG TGTATTCGAG TCATAGGAGC TAGTAATCAG CGATATGCTC
            AGAATTGATG TGTATTCGAA TCATAGGAGC TAGCAATCGT CGATATGCTC
            AAAACTAATG TGCATTCGAG TTATAGGAAC GAGTAATCGA AAATATGCAA

1
((a,b),og);

NEXUS sequential with labels (4)

#NEXUS

[
Generated by HYPHY 2.1320121109beta for Darwin on i386 on Fri Nov  9 14:32:12 2012

]

BEGIN TAXA;
	DIMENSIONS NTAX = 3;
	TAXLABELS
		'a' 'b' 'og' ;
END;

BEGIN CHARACTERS;
	DIMENSIONS NCHAR = 100;
	FORMAT
		DATATYPE = DNA

		GAP=-
		MISSING=?
	;

MATRIX
	'a'   ATGATTCAACCTCAGACCCTTTTAAATGTAGCAGATAACAGTGGAGCTCGAAAATTGATGTGTATTCGAGTCATAGGAGCTAGTAATCAGCGATATGCTC
	'b'   ATGATTCAACCTCAGACCCATTTAAATGTAGCGGATAACAGCGGGGCTCGAGAATTGATGTGTATTCGAATCATAGGAGCTAGCAATCGTCGATATGCTC
	'og'  ATGATTCAACCTCAAACTTATTTAAATGTTGCAGATAATAGTGGAGCTCGAAAACTAATGTGCATTCGAGTTATAGGAACGAGTAATCGAAAATATGCAA;
END;

BEGIN TREES;
	TREE tree = ((a,b),og);
END;

NEXUS interleaved with labels (5)

#NEXUS

[
Generated by HYPHY 2.1320121109beta for Darwin on i386 on Fri Nov  9 14:32:12 2012

]

BEGIN TAXA;
	DIMENSIONS NTAX = 3;
	TAXLABELS
		'a' 'b' 'og' ;
END;

BEGIN CHARACTERS;
	DIMENSIONS NCHAR = 100;
	FORMAT
		DATATYPE = DNA

		GAP=-
		MISSING=?
		INTERLEAVE
	;

MATRIX
	'a'   ATGATTCAACCTCAGACCCTTTTAAATGTAGCAGATAACAGTGGAGCTCG
	'b'   ATGATTCAACCTCAGACCCATTTAAATGTAGCGGATAACAGCGGGGCTCG
	'og'  ATGATTCAACCTCAAACTTATTTAAATGTTGCAGATAATAGTGGAGCTCG


	'a'   AAAATTGATGTGTATTCGAGTCATAGGAGCTAGTAATCAGCGATATGCTC
	'b'   AGAATTGATGTGTATTCGAATCATAGGAGCTAGCAATCGTCGATATGCTC
	'og'  AAAACTAATGTGCATTCGAGTTATAGGAACGAGTAATCGAAAATATGCAA

;
END;

BEGIN TREES;
	TREE tree = ((a,b),og);
END;

NEXUS sequential without labels (6, default)

 #NEXUS

[
Generated by HYPHY 2.1320121109beta for Darwin on i386 on Fri Nov  9 14:32:12 2012

]

BEGIN TAXA;
	DIMENSIONS NTAX = 3;
	TAXLABELS
		'a' 'b' 'og' ;
END;

BEGIN CHARACTERS;
	DIMENSIONS NCHAR = 100;
	FORMAT
		DATATYPE = DNA

		GAP=-
		MISSING=?
		NOLABELS
	;

MATRIX
 ATGATTCAACCTCAGACCCTTTTAAATGTAGCAGATAACAGTGGAGCTCGAAAATTGATGTGTATTCGAGTCATAGGAGCTAGTAATCAGCGATATGCTC
 ATGATTCAACCTCAGACCCATTTAAATGTAGCGGATAACAGCGGGGCTCGAGAATTGATGTGTATTCGAATCATAGGAGCTAGCAATCGTCGATATGCTC
 ATGATTCAACCTCAAACTTATTTAAATGTTGCAGATAATAGTGGAGCTCGAAAACTAATGTGCATTCGAGTTATAGGAACGAGTAATCGAAAATATGCAA;
END;

BEGIN TREES;
	TREE tree = ((a,b),og);
END;

Comma separated characters (8)

A,T,G,A,T,T,C,A,A,C,C,T,C,A,G,A,C,C,C,T,T,T,T,A,A,A,T,G,T,A,G,C,A,G,A,T,A,A,C,A,G,T,G,G,A,G,C,T,C,G,A,A,A,A,T,T,G,A,T,G,T,G,T,A,T,T,C,G,A,G,T,C,A,T,A,G,G,A,G,C,T,A,G,T,A,A,T,C,A,G,C,G,A,T,A,T,G,C,T,C
A,T,G,A,T,T,C,A,A,C,C,T,C,A,G,A,C,C,C,A,T,T,T,A,A,A,T,G,T,A,G,C,G,G,A,T,A,A,C,A,G,C,G,G,G,G,C,T,C,G,A,G,A,A,T,T,G,A,T,G,T,G,T,A,T,T,C,G,A,A,T,C,A,T,A,G,G,A,G,C,T,A,G,C,A,A,T,C,G,T,C,G,A,T,A,T,G,C,T,C
A,T,G,A,T,T,C,A,A,C,C,T,C,A,A,A,C,T,T,A,T,T,T,A,A,A,T,G,T,T,G,C,A,G,A,T,A,A,T,A,G,T,G,G,A,G,C,T,C,G,A,A,A,A,C,T,A,A,T,G,T,G,C,A,T,T,C,G,A,G,T,T,A,T,A,G,G,A,A,C,G,A,G,T,A,A,T,C,G,A,A,A,A,T,A,T,G,C,A,A

FASTA sequential (9)

>a
ATGATTCAACCTCAGACCCTTTTAAATGTAGCAGATAACAGTGGAGCTCG
AAAATTGATGTGTATTCGAGTCATAGGAGCTAGTAATCAGCGATATGCTC
>b
ATGATTCAACCTCAGACCCATTTAAATGTAGCGGATAACAGCGGGGCTCG
AGAATTGATGTGTATTCGAATCATAGGAGCTAGCAATCGTCGATATGCTC
>og
ATGATTCAACCTCAAACTTATTTAAATGTTGCAGATAATAGTGGAGCTCG
AAAACTAATGTGCATTCGAGTTATAGGAACGAGTAATCGAAAATATGCAA


((a,b),og);

FASTA interleaved (10)

>a
>b
>og


 ATGATTCAAC CTCAGACCCT TTTAAATGTA GCAGATAACA GTGGAGCTCG
 ATGATTCAAC CTCAGACCCA TTTAAATGTA GCGGATAACA GCGGGGCTCG
 ATGATTCAAC CTCAAACTTA TTTAAATGTT GCAGATAATA GTGGAGCTCG

 AAAATTGATG TGTATTCGAG TCATAGGAGC TAGTAATCAG CGATATGCTC
 AGAATTGATG TGTATTCGAA TCATAGGAGC TAGCAATCGT CGATATGCTC
 AAAACTAATG TGCATTCGAG TTATAGGAAC GAGTAATCGA AAATATGCAA


((a,b),og);
Personal tools
Namespaces
Variants
Actions
Navigation
Toolbox